ArticleNucleic acids research1996
Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.
Article in Nucleic acids research, 1996. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 9 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
9 citing papers in PubMed, 43 citations in OpenAlex.
- Nontraditional Method for Telomere Staining by PNA Probes.Methods in molecular biology (Clifton, N.J.) · 2023Article
- Remodeling the conformational dynamics of I-motif DNA by helicases in ATP-independent mode at acidic environment.iScience · 2022Article
- i-Motif DNA: structural features and significance to cell biology.Nucleic acids research · 2018Article
- G-quadruplex and i-motif are mutually exclusive in ILPR double-stranded DNA.Biophysical journal · 2012Article
- Article
- Coexistence of an ILPR i-motif and a partially folded structure with comparable mechanical stability revealed at the single-molecule level.Journal of the American Chemical Society · 2010Article
- Multiple four-stranded conformations of human telomere sequence d(CCCTAA) in solution.Nucleic acids research · 2001Article
- In vitro properties of the conserved mammalian protein hnRNP D suggest a role in telomere maintenance.Molecular and cellular biology · 2000Article
- Identification of two human nuclear proteins that recognise the cytosine-rich strand of human telomeres in vitro.Nucleic acids research · 2000Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
4 authors at 1 institution in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.