ArticlePlant molecular biology1995
Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.
Article in Plant molecular biology, 1995. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 126 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
126 citing papers in PubMed, 282 citations in OpenAlex.
- A β-1,3-glucanase antagonizes a phase-separating WRKY repressor to confer saline-alkaline tolerance in rice.The New phytologist · 2026Article
- A VvWRKY8-salicylic acid pathway amplification loop confers resistance to Plasmopara viticola in grapevine.Molecular horticulture · 2026Article
- Overexpression ofInternational journal of molecular sciences · 2025Article
- Phylogenetic relationship of WRKY transcription factors inPlant signaling & behavior · 2025Article
- Overexpression of aInternational journal of molecular sciences · 2025Article
- Many transcription factor families have evolutionarily conserved binding motifs in plants.Plant physiology · 2025Article
- Genome-wide identification and expression profiling of WRKY gene family in grain Amaranth (Amaranthus hypochondriacus L.) under salinity and drought stresses.BMC plant biology · 2025Article
- Identification and Analysis of WRKY Transcription Factors in Response to Cowpea Fusarium Wilt in Cowpea.Plants (Basel, Switzerland) · 2024Article
- MbWRKY53, aInternational journal of molecular sciences · 2024Article
- Genome-Wide Analysis of the WRKY Transcription Factor Family in Roses and Their Putative Role in Defence Signalling in the Rose-Blackspot Interaction.Plants (Basel, Switzerland) · 2024Article
- Genome-Wide Identification and Characterization of WRKY Transcription Factors inInternational journal of molecular sciences · 2023Article
- Genome-Wide Identification and Analysis of theGenes · 2023Article
- The Transcription Factor MbWRKY46 inInternational journal of molecular sciences · 2023Article
- Rice WRKY13 TF protein binds to motifs in the promoter region to regulate downstream disease resistance-related genes.Functional & integrative genomics · 2023Article
- Genome-Wide Identification and Characterization of WRKY Transcription Factors and Their Expression Profile inPlants (Basel, Switzerland) · 2023Article
- Advances in the Research on Plant WRKY Transcription Factors Responsive to External Stresses.Current issues in molecular biology · 2023Review
- Genome-Wide Identification, Evolutionary and Functional Analyses of WRKY Family Members inGenes · 2023Article
- Comprehensive analyses of the citrus WRKY gene family involved in the metabolism of fruit sugars and organic acids.Frontiers in plant science · 2023Article
- Transcriptome-wide identification of WRKY transcription factors and their expression profiles in response to methyl jasmonate inPlant signaling & behavior · 2022Article
- Bioinformatics Analysis ofGenes · 2022Article
66 more citing papers are in PubMed but not listed here.
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
5 authors at 1 institution in 2 countries.
Funding
No grant is acknowledged in the PubMed record.
Abstract
The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.