ArticleMammalian genome : official journal of the International Mammalian Genome Society1993
Characterization of four VNTR loci on human chromosome 6.
Article in Mammalian genome : official journal of the International Mammalian Genome Society, 1993. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Not yet cited in PubMed.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
0 citing papers in PubMed.
No citing paper in PubMed yet.
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
3 authors.
Funding
No grant is acknowledged in the PubMed record.
Abstract
We have determined DNA sequences of four VNTR loci; three in the peritelomeric region of Chromosome (Chr) 6q and one at 6p21. Heterozygosities of these loci among 80 CEPH parents are 78% (D6S139), 69% (D6S149), 76% (D6S161), and 94% (D6S193), respectively. The consensus sequences of repeating units at these VNTR loci are GAGCGGCAGGGGCAGCGGGGCCTGGCCAGAGAG-(34 bp) at D6S139, CCAGGCTGGTTCACAGGCTGTGGGGTGTGATGGGTGATG (39 bp) at D6S149, GGATGGGGTTGGAGGAACTACAGAGCGGTGGTGAAGAGGA (40 bp) at D6S161, and GAGGAGGTGGGGGCCT (16 bp) at D6S193. The GC content of the consensus sequences is 62% as high as reported previously. Furthermore, we have established a PCR assay for D6S193 locus and this will be useful for individual identification or for a study of loss of heterozygosity on the long arm of Chr 6 in malignant tumors.
Indexed as
Identifiers
8422498What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.