ArticleMicrobial cell factories2026
sRNA196 promotes Pseudomonas aeruginosa virulence by regulating target genes PA4398, ZapE and PhoB.
Article in Microbial cell factories, 2026. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Not yet cited in PubMed.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
0 citing papers in PubMed.
No citing paper in PubMed yet.
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
9 authors.
Funding
Abstract
Bacterial sRNAs is important mechanisms regulating bacterial pathogenesis. In this study, We screened a novel sRNA located at PA5007 closely associated with Pseudomonas aeruginosa infection by transcriptome sequencing196. And using transcriptome sequencing as well as public databases, the sequence was found to be TCCGGGGCACGGCGCAGCATCGGCTCCAGGTCCTTGACCTGGTCGCGGCGGGCCGAACCA. We constructed sRNA196 gene-deficient and overexpression strains in PAO1 and demonstrated its presence by Northern blotting. The results showed that sRNA196 positively regulated pyocyanin synthesis, biofilm formation, and motility in P. aeruginosa. In addition, sRNA196 was able to promote P. aeruginosa adhesion and invasion ability in A549 cells as well as enhance P. aeruginosa survival in RAW264.7 cells. Furthermore, we demonstrated that sRNA196 can positively regulate several target genes including PA4398, ZapE, PhoB by fluorescense reporting system, and further verified the effects of these target genes on the relevant phenotypes. In summary, this study identified a new small RNA, sRNA196, that positively regulates virulence, which helps us to have a more comprehensive and clearer understanding of the role played by sRNAs in the regulation of virulence in P. aeruginosa.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.