ArticleAnnals of hematology2025
Identification of a novel PML exon 6 splice variant in atypical PML::RARα transcripts in acute promyelocytic leukemia.
Article in Annals of hematology, 2025. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Not yet cited in PubMed.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
0 citing papers in PubMed.
No citing paper in PubMed yet.
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
6 authors.
Funding
Abstract
The PML::RARα fusion gene resulting from the t(15;17) chromosomal translocation serves as the pathognomonic molecular marker of acute promyelocytic leukemia (APL), which has been shown to directly repress transcription of retinoic acid (RA)-responsive genes, ultimately inducing granulocytic differentiation arrest. In this study, we report an APL case harboring an atypical PML::RARα fusion transcript characterized by a novel splice site variant (GCCaggccc) within PML exon 6, resulting in an 80 base pairs deletion of the distal exonic sequence with concomitant insertion of 23 exogenous nucleotides (agagccttcttctctctgggacaag). To our knowledge, this isoform differs from all previously described PML::RARα fusion transcripts. This case emphasizes the importance of molecular characterization in APL diagnosis and minimal residual disease (MRD) monitoring, though further studies are required to establish its clinical correlation.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.