ArticleMolecular biotechnology2025
Development of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.
Article in Molecular biotechnology, 2025. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Not yet cited in PubMed.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
0 citing papers in PubMed.
No citing paper in PubMed yet.
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
2 authors.
Funding
Abstract
The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target. A molecular beacon of 33 nucleotides was designed with the sequence 5'[Fluorescein] ATAGTCCTTCAACAATCTTATCCCTAGCACTAT[Dabcyl]3', incorporating stem and loop regions. Secondary and tertiary structure characterizations confirmed the desired stem-loop structure without internal secondary structures. The thermal stability of the molecular beacon-target complex was studied using a temperature vs. Gibbs free energy change plot, melting curve analysis based on absorbance vs. temperature, and an experimental fluorescence resonance energy transfer melting assay. The melting temperature of the molecular beacon-target complex was experimentally determined to be 62 °C. The spectral analysis showed fluorescence restoration in the presence of the synthetic VP6 target. The assay conditions were optimized with an excitation wavelength of 470 nm and a 10-min incubation time. The assay demonstrated a linear correlation between fluorescence intensity restoration and target concentration, with a limit of detection of 18.8 nM. Interference studies with single mismatch, double mismatch, and scrambled targets revealed that the molecular beacon has strong specificity for the VP6 target, effectively discriminating against non-target sequences. This work demonstrates the molecular beacon's potential as a sensitive and specific tool for detecting rotavirus A VP6 gene, with promising applications in diagnostic assays for the rotavirus disease management.
Indexed as
Identifiers
39739192What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.