ArticleMolecular medicine reports2024
[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis.
Article in Molecular medicine reports, 2024. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 1 paper.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
1 citing paper in PubMed.
- KIF23 in disease pathogenesis and therapeutics : from molecular mechanisms to clinical translation.Cancer cell international · 2026Review
Corrections and comments
- Erratum for
Authors and funding
6 authors.
Funding
No grant is acknowledged in the PubMed record.
Abstract
Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR‑545‑3p (5'‑TGGCTCAGTTCAGCAGGAAC‑3') was actually for miR‑24‑3p (5'‑UGGCUCAGUUCAGCAGGAACAG‑3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR‑670‑5p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I. The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR‑670‑5p and miR‑545‑3p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.