ArticleMolecular therapy : the journal of the American Society of Gene Therapy2023
Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.
Article in Molecular therapy : the journal of the American Society of Gene Therapy, 2023. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 9 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
9 citing papers in PubMed, 10 citations in OpenAlex.
- A Multiepitope Intranasal Adenoviral Vaccine Induces Robust Mucosal Immunity and Protection against SARS‑CoV‑2.Journal of nanobiotechnology · 2026Article
- A Split sfGFP-Based Signal-Amplified Reporter System for Enhanced Detection of Promoter Activity.Biotechnology journal · 2026Article
- Unlocking mRNA-driven CRISPR-Cas9 gene therapy via optimizing mRNA and the delivery vectors.Molecular therapy. Nucleic acids · 2025Review
- Preparation and Immunological Efficacy Evaluation of mRNA Vaccines Targeting the Spike Protein of Bovine Coronavirus.Vaccines · 2025Article
- Next-Generation Adenoviral Vector-Based Vaccines for Severe Acute Respiratory Syndrome Coronavirus-2.Vaccines · 2025Review
- Rational optimization of glycoprotein E (gE)-encoding mRNA for improved Varicella-zoster virus mRNA vaccine development.Emerging microbes & infections · 2024Article
- Article
- Article
- The Production of Complement Inhibitor Proteins in Mammalian Cell Lines-Light at the End of the Tunnel?Biomedicines · 2024Review
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
17 authors at 1 institution in 1 country.
Funding
Abstract
Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.