ArticleChemistrySelect2022
Identification of a Potential mRNA-based Vaccine Candidate against the SARS-CoV-2 Spike Glycoprotein: A Reverse Vaccinology Approach.
Article in ChemistrySelect, 2022. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 7 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
7 citing papers in PubMed, 15 citations in OpenAlex.
- Design of a Multiepitope Pan-Proteomic mRNA Vaccine Construct Against African Swine Fever Virus: A Reverse Vaccinology Approach.Veterinary medicine international · 2025Article
- Article
- Advances of Reverse Vaccinology for mRNA Vaccine Design against SARS-CoV-2: A Review of Methods and Tools.Viruses · 2023Review
- MasitinibL shows promise as a drug-like analog of masitinib that elicits comparable SARS-Cov-2 3CLpro inhibition with low kinase preference.Scientific reports · 2023Article
- The Advantage of Using Immunoinformatic Tools on Vaccine Design and Development for Coronavirus.Vaccines · 2022Review
- Immunology to Immunotherapeutics of SARS-CoV-2: Identification of Immunogenic Epitopes for Vaccine Development.Current microbiology · 2022Review
- Identification of a Potential mRNA-based Vaccine Candidate against the SARS-CoV-2 Spike Glycoprotein: A Reverse Vaccinology Approach.ChemistrySelect · 2022Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
6 authors at 1 institution in 2 countries.
Funding
No grant is acknowledged in the PubMed record.
Abstract
The emergence of the novel coronavirus (SARS-CoV-2) in December 2019 has generated a devastating global consequence which makes the development of a rapidly deployable, effective and safe vaccine candidate an imminent global health priority. The design of most vaccine candidates has been directed at the induction of antibody responses against the trimeric spike glycoprotein of SARS-CoV-2, a class I fusion protein that aids ACE2 (angiotensin-converting enzyme 2) receptor binding. A variety of formulations and vaccinology approaches are being pursued for targeting the spike glycoprotein, including simian and human replication-defective adenoviral vaccines, subunit protein vaccines, nucleic acid vaccines and whole-inactivated SARS-CoV-2. Here, we directed a reverse vaccinology approach towards the design of a nucleic acid (mRNA-based) vaccine candidate. The "YLQPRTFLL" peptide sequence (position 269-277) which was predicted to be a B cell epitope and likewise a strong binder of the HLA*A-0201 was selected for the design of the vaccine candidate, having satisfied series of antigenicity assessments. Through the codon optimization protocol, the nucleotide sequence for the vaccine candidate design was generated and targeted at the human toll-like receptor 7 (TLR7). Bioinformatics analyses showed that the sequence "UACCUGCAGCCGCGUACCUUCCUGCUG" exhibited a strong affinity and likewise was bound to a stable cavity in the TLR7 pocket. This study is therefore expected to contribute to the research efforts directed at securing definitive preventive measures against the SARS-CoV-2 infection.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.