Evidence map›Paper›PMID 35163018›Full record

ArticleInternational journal of molecular sciences2022

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

Carmen Festa, Veronica Esposito, Daniela Benigno, Simona De Marino, Angela Zampella, Antonella Virgilio, Aldo Galeone

Open access · goldAbstract read
PubMed Full text at PMC Publisher
In one paragraph

Article in International journal of molecular sciences, 2022. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 2 papers.

0numbers the graph read from it
0cells of the map it votes in
2citing papers in PubMed
0.3field-weighted citation impact, top 46% of its field
1 · What the graph read from it

What it found

Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.

The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.

2 · The registry

The trial behind it

Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.

Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.

3 · Its place in the literature

Who cites it

2 citing papers in PubMed, 5 citations in OpenAlex.

  1. Article
  2. Article
4 · The record

Corrections and comments

PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.

5 · Who and what money

Authors and funding

7 authors at 1 institution in 1 country.

Carmen FestaDepartment of Pharmacy, University of Naples Federico II, Via D. Montesano 49, I-80131 Naples, Italy.ORCID 0000-0001-8879-4332
Veronica EspositoDepartment of Pharmacy, University of Naples Federico II, Via D. Montesano 49, I-80131 Naples, Italy.ORCID 0000-0002-1724-7128
Daniela BenignoDepartment of Pharmacy, University of Naples Federico II, Via D. Montesano 49, I-80131 Naples, Italy.ORCID 0000-0002-5371-1813
Simona De MarinoDepartment of Pharmacy, University of Naples Federico II, Via D. Montesano 49, I-80131 Naples, Italy.ORCID 0000-0002-0300-5048
Angela ZampellaDepartment of Pharmacy, University of Naples Federico II, Via D. Montesano 49, I-80131 Naples, Italy.
Antonella VirgilioDepartment of Pharmacy, University of Naples Federico II, Via D. Montesano 49, I-80131 Naples, Italy.ORCID 0000-0002-0873-5250
Aldo GaleoneDepartment of Pharmacy, University of Naples Federico II, Via D. Montesano 49, I-80131 Naples, Italy.ORCID 0000-0001-8805-6348
University of Naples Federico II · IT

Funding

No grant is acknowledged in the PubMed record.

6 · The paper itself

Abstract

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (A

Indexed as

G-QuadruplexesTelomereCatalysisDeoxyadenosinesDNAHumansOligonucleotidesStereoisomerism2'-deoxy-7,8-dihydro-8-oxoadenosine8-bromo-2'-deoxyadenosineDeoxyadenosinesDNAOligonucleotidesasymmetric synthesiscatalytic DNAsulfoxidationtelomeric G-quadruplex analogues

Identifiers

PMID35163018
PMCPMC8835054
OpenAlexW4206699438

What OpenQuestion holds

Textmetadata
LicenceCC BY
Read underepoch 390

Registered trials

None linked

Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.