ArticleMolecular genetics & genomic medicine2021
Five novel globin gene mutations identified in five Chinese families by next-generation sequencing.
Article in Molecular genetics & genomic medicine, 2021. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 3 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
3 citing papers in PubMed, 4 citations in OpenAlex.
- An Integrated Genotyping Strategy for α/β-Thalassemia: Based on the Analysis of the Coding Sequences and Expression Levels of HBA2, HBA1, and HBB in Peripheral Blood mRNA.Journal of clinical laboratory analysis · 2026Article
- Long-Read Sequencing Identified a Large NovelHuman mutation · 2023Article
- Five novel globin gene mutations identified in five Chinese families by next-generation sequencing.Molecular genetics & genomic medicine · 2021Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
16 authors at 3 institutions in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
backgroundThalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of β-thalassemia caused by five different mutations in the globin gene.
methodsNext-generation sequencing (NGS) was used to identify novel α- and β-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis.
resultsNGS revealed five novel cases of α- and β-thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed.
conclusionFive novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.