ArticleScientific reports2021
Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens.
Article in Scientific reports, 2021. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 7 papers, 1 of them a synthesis that pooled it.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
7 citing papers in PubMed, 1 synthesis or guideline pooled it, 20 citations in OpenAlex.
- Trends and Challenges of SPR Aptasensors in Viral Diagnostics: A Systematic Review and Meta-Analysis.Biosensors · 2025Pooled it
- Translational opportunities in aptamer and nanobody lateral flow assays within the WHO REASSURED framework.Sensors & diagnostics · 2026Review
- Antibodies targeting the Crimean-Congo Hemorrhagic Fever Virus nucleoprotein protect via TRIM21.Nature communications · 2024Article
- Recent Advances in Crimean-Congo Hemorrhagic Fever Virus Detection, Treatment, and Vaccination: Overview of Current Status and Challenges.Biological procedures online · 2024Review
- Aptamer-based diagnosis of various SARS-CoV2 strains isolated from clinical specimens.Heliyon · 2023Article
- Aptamers targeting SARS-COV-2: a promising tool to fight against COVID-19.Trends in biotechnology · 2023Review
- Investigation Around Cases of Crimean-Congo Hemorrhagic Fever-Mauritania, 2022.Open forum infectious diseases · 2022Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
4 authors at 2 institutions in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.