ArticleAdvances in cell and gene therapy2021
An in silico analysis of effective siRNAs against COVID-19 by targeting the leader sequence of SARS-CoV-2.
Article in Advances in cell and gene therapy, 2021. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 12 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
12 citing papers in PubMed.
- Beyond Variant Evolution: Structurally and Functionally Conserved Regions in the 5'UTR of SARS-CoV-2 as Resilient Antiviral Targets.Biomedicines · 2026Article
- Therapeutic Approaches of Viral Gene Silencing by Small Interfering RNA: Strategies to Prevent the Emergence of Antiviral Resistant Escape Mutants.Pharmaceuticals (Basel, Switzerland) · 2025Review
- In Silico and In Vitro development of novel small interfering RNAs (siRNAs) to inhibit SARS-CoV-2.Computational and structural biotechnology journal · 2025Article
- Potential of siRNA in COVID-19 therapy: Emphasis onFrontiers in bioengineering and biotechnology · 2023Review
- Computational study and design of effective siRNAs to silence structural proteins associated genes of Indian SARS-CoV-2 strains.Computational biology and chemistry · 2022Article
- Effect of insilico predicted and designed potential siRNAs on inhibition of SARS-CoV-2 in HEK-293 cells.Journal of King Saud University. Science · 2022Article
- In silico prediction and experimental evaluation of potential siRNAs against SARS-CoV-2 inhibition in Vero E6 cells.Journal of King Saud University. Science · 2022Article
- Nanoparticle Delivery Platforms for RNAi Therapeutics Targeting COVID-19 Disease in the Respiratory Tract.International journal of molecular sciences · 2022Review
- Targeting genomic SARS-CoV-2 RNA with siRNAs allows efficient inhibition of viral replication and spread.Nucleic acids research · 2022Article
- Development and application of ribonucleic acid therapy strategies against COVID-19.International journal of biological sciences · 2022Review
- Inhibition of SARS-CoV-2 Replication by a Small Interfering RNA Targeting the Leader Sequence.Viruses · 2021Article
- An in silico analysis of effective siRNAs against COVID-19 by targeting the leader sequence of SARS-CoV-2.Advances in cell and gene therapy · 2021Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
2 authors.
Funding
No grant is acknowledged in the PubMed record.
Abstract
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is a retrovirus having genome size of around 30 kb. Its genome contains a highly conserved leader sequence at its 5' end, which is added to all subgenomic mRNAs at their 5' terminus by a discontinuous transcription mechanism and regulates their translation. Targeting the leader sequence by RNA interference can be an effective approach to inhibit the viral replication. In the present study an in-silico prediction of highly effective siRNAs was performed to target the leader sequence using the online software siDirect version 2.0. Low seed-duplex stability, exact complementarity with target, at least three mismatches with any off-target and least number of off-targets, were considered as effective criteria for highly specific siRNA. Further validation of siRNA affinity for the target was accomplished by molecular docking by HNADOCK online server. Our results revealed four potential siRNAs, of which siRNA having guide strand sequence 5'GUUUAGAGAACAGAUCUACAA3' met almost all specificity criteria with no off-targets for guide strand. Molecular docking of all predicted siRNAs (guide strand) with the target leader sequence depicted highest binding score of -327.45 for above-mentioned siRNA. Furthermore, molecular docking of the passenger strand of the best candidate with off-target sequences gave significantly low binding scores. Hence, 5'GUUUAGAGAACAGAUCUACAA3' siRNA possess great potential to silence the leader sequence of SARS-CoV-2 with least off-target effect. Present study provides great scope for development of gene therapy against the prevailing COVID-19 disease, thus further research in this concern is urgently demanded.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.