ArticleVeterinary world2020
Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia.
Article in Veterinary world, 2020. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 2 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
2 citing papers in PubMed, 12 citations in OpenAlex.
- Are online meatball restaurants in Indonesia committed to their declared Halal label?Veterinary world · 2024Article
- Phenotype and genotype of Boerka goats raised in Bali.Veterinary world · 2023Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
3 authors at 1 institution in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
BACKGROUND AND
aimMeatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs. MATERIALS AND
methodsBeef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3.
resultsOur study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs.
conclusionThe PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.