ArticleNucleic acids research2020
Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.
Article in Nucleic acids research, 2020. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 8 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
8 citing papers in PubMed, 19 citations in OpenAlex.
- CGGBP1-Regulated Heterogeneous C-T Transition Rates Correlate with G-quadruplex Potential of Terrestrial Vertebrate Genomes.Journal of molecular evolution · 2026Article
- Topological rules and anomalies in intramolecular G-quadruplex folding: a comprehensive study.Nucleic acids research · 2026Article
- Article
- Beyond Structure: Methylation Fine-Tunes Stability and Folding Kinetics of bcl2Mid G-Quadruplex.Angewandte Chemie (International ed. in English) · 2025Article
- Effects of 5-Methyl-2'-Deoxycytidine in G-Quadruplex Forming Aptamers d(GBiomolecules · 2025Article
- Comprehensive analysis of intramolecular G-quadruplex structures: furthering the understanding of their formalism.Nucleic acids research · 2024Article
- G4access identifies G-quadruplexes and their associations with open chromatin and imprinting control regions.Nature genetics · 2023Article
- Effects of Length and Loop Composition on Structural Diversity and Similarity of (GMolecules (Basel, Switzerland) · 2020Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
6 authors at 3 institutions in 2 countries.
Funding
No grant is acknowledged in the PubMed record.
Abstract
Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.