ArticleChinese medical journal2019
Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis.
Article in Chinese medical journal, 2019. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 5 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
5 citing papers in PubMed.
- Microbial Source Tracking and Community Assembly Mechanisms in Fenhe Reservoir Wetland.Microorganisms · 2026Article
- The composition and function succession of lignocellulose-degrading microbial consortia drives in situ decomposition of rice straw in paddy fields.Environmental microbiome · 2026Article
- Mixed Aspergillosis and Mucormycosis Infections in Patients with COVID-19: Case Series and Literature Review.Mycopathologia · 2024Review
- Assessing the structure and diversity of fungal community in plant soil under different climatic and vegetation conditions.Frontiers in microbiology · 2023Article
- Effects of fecal microbiota transplantation from yaks on weaning diarrhea, fecal microbiota composition, microbial network structure and functional pathways in Chinese Holstein calves.Frontiers in microbiology · 2022Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
5 authors.
Funding
No grant is acknowledged in the PubMed record.
Abstract
backgroundCryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons.
methodsThe CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software.
resultsThe 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed.
conclusionsThe metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.