ArticleNucleic acids research2019
Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4.
Article in Nucleic acids research, 2019. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 13 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
13 citing papers in PubMed, 32 citations in OpenAlex.
- Polyamines are i-motif disruptors.Molecular therapy. Nucleic acids · 2026Article
- Multivalent cations stabilize DNA duplexes beyond charge neutralization.Chemical science · 2026Article
- Effects of synergistic/antagonistic interactions between spermidine (3+) and putrescine (2+) on gene expression through higher-order DNA structural modification.European biophysics journal : EBJ · 2026Article
- Direct SERS Detection of Nucleic Acids in the Presence of Spermine: A Unified Nanoparticle Platform Allows for the Elucidation of Surface Adsorption Hierarchies.The journal of physical chemistry. C, Nanomaterials and interfaces · 2025Article
- Polyamines in Plant-Pathogen Interactions: Roles in Defense Mechanisms and Pathogenicity with Applications in Fungicide Development.International journal of molecular sciences · 2024Review
- Mitochondrial transcription factor A (TFAM) has 5'-deoxyribose phosphate lyase activity in vitro.DNA repair · 2024Article
- Article
- Molecular targets of spermidine: implications for cancer suppression.Cell stress · 2023Article
- mRNA Vaccine Platform: mRNA Production and Delivery.Russian journal of bioorganic chemistry · 2023Article
- Role of Polyamines and Hypusine in β Cells and Diabetes Pathogenesis.Metabolites · 2022Review
- Caging Polycations: Effect of Increasing Confinement on the Modes of Interaction of SpermidineFrontiers in chemistry · 2022Article
- Molecular dynamics study of the competitive binding of hydrogen peroxide and water molecules with DNA phosphate groups.European biophysics journal : EBJ · 2021Article
- Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
4 authors at 4 institutions in 5 countries.
Funding
No grant is acknowledged in the PubMed record.
Abstract
The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.