ArticleScientific reports2019
Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation.
Article in Scientific reports, 2019. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 8 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
8 citing papers in PubMed, 22 citations in OpenAlex.
- CRISPR-Cas9 targeting of G-Quadruplex DNA in ADH1 promoter highlights its role in transcriptome and metabolome regulation.Nucleic acids research · 2025Article
- Unlocking the potential of protein-derived peptides to target G-quadruplex DNA: from recognition to anticancer activity.Nucleic acids research · 2024Article
- Crosstalk between G-Quadruplexes and Dnmt3a-Mediated Methylation of theInternational journal of molecular sciences · 2023Article
- G-Quadruplexes Formation by theMolecules (Basel, Switzerland) · 2023Article
- Targeted RASSF1A expression inhibits proliferation of HER2‑positive breast cancer cellsExperimental and therapeutic medicine · 2023Article
- Impact of G-Quadruplex Structures on Methylation of Model Substrates by DNA Methyltransferase Dnmt3a.International journal of molecular sciences · 2022Article
- G4LDB 2.2: a database for discovering and studying G-quadruplex and i-Motif ligands.Nucleic acids research · 2022Article
- Regulation of PDGFR-β gene expression by targeting the G-vacancy bearing G-quadruplex in promoter.Nucleic acids research · 2021Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
6 authors at 2 institutions in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further evidence from a luciferase reporter assay, Q-RT-PCR and Western blotting indicates that S1 G-quadruplex formation can repress her2 promoter activity, and a selected G-quadruplex ligand cβ can enhance the repression by down regulating her2 transcription and expression. These findings provide a G-quadruplex target and perspective implications in her2 transcriptional regulation.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.