ArticleNucleic acids research2019
Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.
Article in Nucleic acids research, 2019. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 33 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
33 citing papers in PubMed, 54 citations in OpenAlex.
- PNA-ligand conjugates enable site-selective and directional targeting of adjacent G-quadruplexes.Chemical science · 2026Article
- Regulatory roles of G-quadruplexes and G-quadruplex-binding proteins across the enhancer and promoter of the HBV genome.Virology journal · 2026Article
- How loop lengths shape topological preferences of two-tetrad G-quadruplexes.Nucleic acids research · 2026Article
- Topological rules and anomalies in intramolecular G-quadruplex folding: a comprehensive study.Nucleic acids research · 2026Article
- From alkylating to shape-shifting G-quadruplex ligands: the RHAU peptide story.Nucleic acids research · 2026Article
- Indirect identification of genomic G-quadruplexes via a small protein probe that specifically recognizes C-rich single-stranded DNA.Nucleic acids research · 2026Article
- Revealing G4 Structures as Drug Targets: Exploring the Potential of Novel Therapeutic Agents.Research (Washington, D.C.) · 2026Review
- Beyond Structure: Methylation Fine-Tunes Stability and Folding Kinetics of bcl2Mid G-Quadruplex.Angewandte Chemie (International ed. in English) · 2025Article
- G-Quadruplex-Based Splice Switching as a Therapeutic Approach in Duchenne Muscular Dystrophy.ACS chemical biology · 2025Article
- Kanamycin and G-Quadruplexes: An Exploration of Binding Interactions.Molecules (Basel, Switzerland) · 2024Article
- RNA G-quadruplex formation in biologically important transcribed regions: can two-tetrad intramolecular RNA quadruplexes be formed?Nucleic acids research · 2024Article
- Two rhenium compounds with benzimidazole ligands: synthesis and DNA interactions.RSC advances · 2024Article
- Protein G-quadruplex interactions and their effects on phase transitions and protein aggregation.Nucleic acids research · 2024Article
- Comprehensive analysis of intramolecular G-quadruplex structures: furthering the understanding of their formalism.Nucleic acids research · 2024Article
- Protein G-quadruplex interactions and their effects on phase transitions and protein aggregation.bioRxiv : the preprint server for biology · 2024Article
- Application of G-quadruplex targets in gastrointestinal cancers: Advancements, challenges and prospects.World journal of gastrointestinal oncology · 2023Review
- Inhibited complete folding of consecutive human telomeric G-quadruplexes.Nucleic acids research · 2023Article
- Higher-order G-quadruplexes in promoters are untapped drug targets.Frontiers in chemistry · 2023Review
- Solution structure of a thrombin binding aptamer complex with a non-planar platinum(ii) compound.Chemical science · 2022Article
- G4Boost: a machine learning-based tool for quadruplex identification and stability prediction.BMC bioinformatics · 2022Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
4 authors at 3 institutions in 2 countries.
Funding
No grant is acknowledged in the PubMed record.
Abstract
In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.