ArticleGenes2018
Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus.
Article in Genes, 2018. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 14 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
14 citing papers in PubMed, 25 citations in OpenAlex.
- Characterization of Hibiscus Chlorotic Ringspot Virus-Derived vsiRNAs from Infected Hibiscus rosa-sinensis in China.The plant pathology journal · 2024Article
- Toward a Categorization of Virus-ncRNA Interactions in the World of RNA to Disentangle the Tiny Secrets of Dengue Virus.Viruses · 2024Review
- [SARS-CoV-2 with transcription regulatory sequence motif mutation poses a greater threat].Nan fang yi ke da xue xue bao = Journal of Southern Medical University · 2022Article
- How the Replication and Transcription Complex Functions in Jumping Transcription of SARS-CoV-2.Frontiers in genetics · 2022Article
- Severe acute respiratory syndrome coronavirus (SARS-CoV)-2 infection induces dysregulation of immunity:International journal of medical sciences · 2021Article
- The Potential Therapeutic Effect of RNA Interference and Natural Products on COVID-19: A Review of the Coronaviruses Infection.Frontiers in pharmacology · 2021Review
- Genomic Feature Analysis of Betacoronavirus Provides Insights Into SARS and COVID-19 Pandemics.Frontiers in microbiology · 2021Article
- Characterization of Hibiscus Latent Fort Pierce Virus-Derived siRNAs in InfectedThe plant pathology journal · 2020Article
- Full-length genome sequence of segmented RNA virus from ticks was obtained using small RNA sequencing data.BMC genomics · 2020Article
- Analysis of factors associated with disease outcomes in hospitalized patients with 2019 novel coronavirus disease.Chinese medical journal · 2020Article
- Epigenetic Regulator miRNA Pattern Differences Among SARS-CoV, SARS-CoV-2, and SARS-CoV-2 World-Wide Isolates Delineated the Mystery Behind the Epic Pathogenicity and Distinct Clinical Characteristics of Pandemic COVID-19.Frontiers in genetics · 2020Article
- siRNAs Derived from Cymbidium Mosaic Virus and Odontoglossum Ringspot Virus Down-modulated the Expression Levels of Endogenous Genes inThe plant pathology journal · 2019Article
- Article
- Using Pan RNA-Seq Analysis to Reveal the Ubiquitous Existence of 5' and 3' End Small RNAs.Frontiers in genetics · 2019Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
10 authors at 2 institutions in 1 country.
Funding
Abstract
In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.