ArticleSaudi medical journal2017
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy.
Article in Saudi medical journal, 2017. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 1 paper.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
1 citing paper in PubMed, 1 citations in OpenAlex.
- A new dysferlin gene mutation in a Portuguese family with Miyoshi myopathy.BMJ case reports · 2021Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
9 authors at 3 institutions in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
objectivesTo identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM) like elevated serum creatine kinase (CK) levels, distal muscle weakness, myopathic changes in electromyography (EMG) and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT) in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X), which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X) in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.