Evidence map›Paper›PMID 29098346›Full record

ArticleOsteoporosis international : a journal established as result of cooperation between the European Foundation for Osteoporosis and the National Osteoporosis Foundation of the USA2018

Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing.

Y Liu, Asan, D Ma, F Lv, X Xu, J Wang, W Xia, Y Jiang, O Wang, X Xing and 8 more

Abstract readPublished Erratum
PubMed Publisher
In one paragraph

Article in Osteoporosis international : a journal established as result of cooperation between the European Foundation for Osteoporosis and the National Osteoporosis Foundation of the USA, 2018. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Not yet cited in PubMed.

0numbers the graph read from it
0cells of the map it votes in
0citing papers in PubMed
–field-weighted citation impact
1 · What the graph read from it

What it found

Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.

The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.

2 · The registry

The trial behind it

Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.

Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.

3 · Its place in the literature

Who cites it

0 citing papers in PubMed.

No citing paper in PubMed yet.

4 · The record

Corrections and comments

5 · Who and what money

Authors and funding

18 authors.

Y LiuDepartment of Endocrinology, Key Laboratory of Endocrinology, Ministry of Health, Peking Union Medical College Hospital, Chinese Academy of Medical Science, Beijing, 100730, China.
AsanTianjin Medical Laboratory, BGI-Tianjin, BGI-Shenzhen, Tianjin, 300308, China.
D MaDepartment of Endocrinology, Key Laboratory of Endocrinology, Ministry of Health, Peking Union Medical College Hospital, Chinese Academy of Medical Science, Beijing, 100730, China.
F LvDepartment of Endocrinology, Key Laboratory of Endocrinology, Ministry of Health, Peking Union Medical College Hospital, Chinese Academy of Medical Science, Beijing, 100730, China.
X XuDepartment of Endocrinology, Key Laboratory of Endocrinology, Ministry of Health, Peking Union Medical College Hospital, Chinese Academy of Medical Science, Beijing, 100730, China.
J WangDepartment of Endocrinology, Key Laboratory of Endocrinology, Ministry of Health, Peking Union Medical College Hospital, Chinese Academy of Medical Science, Beijing, 100730, China.
W XiaDepartment of Endocrinology, Key Laboratory of Endocrinology, Ministry of Health, Peking Union Medical College Hospital, Chinese Academy of Medical Science, Beijing, 100730, China.
Y JiangDepartment of Endocrinology, Key Laboratory of Endocrinology, Ministry of Health, Peking Union Medical College Hospital, Chinese Academy of Medical Science, Beijing, 100730, China.
O WangDepartment of Endocrinology, Key Laboratory of Endocrinology, Ministry of Health, Peking Union Medical College Hospital, Chinese Academy of Medical Science, Beijing, 100730, China.
X XingDepartment of Endocrinology, Key Laboratory of Endocrinology, Ministry of Health, Peking Union Medical College Hospital, Chinese Academy of Medical Science, Beijing, 100730, China.
W YuDepartment of Radiology, Peking Union Medical College Hospital, Chinese Academy of Medical Science, Beijing, 100730, China.
J WangTianjin Medical Laboratory, BGI-Tianjin, BGI-Shenzhen, Tianjin, 300308, China.
J SunTianjin Medical Laboratory, BGI-Tianjin, BGI-Shenzhen, Tianjin, 300308, China.
L SongTianjin Medical Laboratory, BGI-Tianjin, BGI-Shenzhen, Tianjin, 300308, China.
Y ZhuTianjin Medical Laboratory, BGI-Tianjin, BGI-Shenzhen, Tianjin, 300308, China.
H YangBGI-Shenzhen, Shenzhen, 518083, China.
J WangBGI-Shenzhen, Shenzhen, 518083, China.
M LiDepartment of Endocrinology, Key Laboratory of Endocrinology, Ministry of Health, Peking Union Medical College Hospital, Chinese Academy of Medical Science, Beijing, 100730, China. limeilzh@sina.com.

Funding

No grant is acknowledged in the PubMed record.

6 · The paper itself

Abstract

In Table 2:Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC.Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT.In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).

Identifiers

PMID29098346

What OpenQuestion holds

Textmetadata
Read underepoch 390

Registered trials

None linked

Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.