ArticleScientific reports2017
Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.
Article in Scientific reports, 2017. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 24 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
24 citing papers in PubMed.
- Rapid authentication of endangeredFrontiers in plant science · 2025Article
- DNA barcoding in herbal medicine: Retrospective and prospective.Journal of pharmaceutical analysis · 2023Review
- DNA barcoding: an efficient technology to authenticate plant species of traditional Chinese medicine and recent advances.Chinese medicine · 2022Review
- Strategies for molecular authentication of herbal products: from experimental design to data analysis.Chinese medicine · 2022Review
- A Review on Application of DNA Barcoding Technology for Rapid Molecular Diagnostics of Adulterants in Herbal Medicine.Drug safety · 2022Review
- The biology of medicinal resource substitution in Salvia.Chinese medicine · 2021Article
- Niche specificity and functional diversity of the bacterial communities associated with Ginkgo biloba and Panax quinquefolius.Scientific reports · 2021Article
- Toxicity as prime selection criterion among SARS-active herbal medications.Phytomedicine : international journal of phytotherapy and phytopharmacology · 2021Review
- Validation of a Triplex Quantitative Polymerase Chain Reaction Assay for Detection and Quantification of Traditional Protein Sources,Frontiers in plant science · 2021Article
- Biological Ingredient Analysis of Traditional Herbal Patent Medicine Fuke Desheng Wan Using the Shotgun Metabarcoding Approach.Frontiers in pharmacology · 2021Article
- Precise Species Detection in Traditional Herbal Patent Medicine, Qingguo Wan, Using Shotgun Metabarcoding.Frontiers in pharmacology · 2021Article
- Lonicerae japonicae flos and Lonicerae flos: a systematic review of ethnopharmacology, phytochemistry and pharmacology.Phytochemistry reviews : proceedings of the Phytochemical Society of Europe · 2020Review
- Screen for Potential Candidate Alternatives ofInternational journal of molecular sciences · 2019Article
- A Simple, Rapid, and Practical Method for DistinguishingMolecules (Basel, Switzerland) · 2019Article
- Article
- DetectingGenes · 2019Article
- DNA Mini-Barcoding: A Derived Barcoding Method for Herbal Molecular Identification.Frontiers in plant science · 2019Review
- Mitigating the Impact of Admixtures in Thai Herbal Products.Frontiers in pharmacology · 2019Review
- The DNA-Based Authentication of Commercial Herbal Products Reveals Their Globally Widespread Adulteration.Frontiers in pharmacology · 2019Review
- Evolutionary Analysis of Plastid Genomes of SevenInternational journal of molecular sciences · 2018Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
8 authors.
Funding
No grant is acknowledged in the PubMed record.
Abstract
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.