ArticleJournal of molecular modeling2017
Melting of polymeric DNA double helix at elevated temperature: a molecular dynamics approach.
Article in Journal of molecular modeling, 2017. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 2 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
2 citing papers in PubMed, 6 citations in OpenAlex.
- Molecular Interpretation of Temperature-Induced DNA Melting Monitored through Base Dipole Moment Changes as a Surrogate of the Hypochromic Shift.The journal of physical chemistry letters · 2026Article
- Asymmetric base-pair opening drives helicase unwinding dynamics.Proceedings of the National Academy of Sciences of the United States of America · 2019Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
3 authors at 2 institutions in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
Genomic DNA of higher organisms exists as extremely long polymers, while in bacteria and other lower organisms it is circular with no terminal base pairs. Temperature-induced melting of the DNA double helix by localized strand separation has been unattainable by molecular dynamic simulations due to more rapid fraying of the terminal base pairs in oligomeric DNA. However, local-sequence-dependent unfolding of the DNA double helix is extremely important for understanding various biochemical phenomena, and can be addressed by simulating a model polymeric DNA duplex. Here, we present simulations of polymeric B-DNA of sequence d(CGCGCGCGAATTCGCGCGCG)
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.