ArticlePrion2017
Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.
Article in Prion, 2017. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 25 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
25 citing papers in PubMed, 47 citations in OpenAlex.
- Investigation of a RareAnimals : an open access journal from MDPI · 2026Article
- Chromatin accessibility and transcriptomic profiles of sheep pituitary function associated with fecundity.BMC genomics · 2025Article
- A Functional 67-bp Duplication Locating at the Core Promoter Region within the BovineAnimals : an open access journal from MDPI · 2024Article
- Investigation of the Seroprevalence of Brucella Antibodies and Characterization of Field Strains in Immunized Dairy Cows byVeterinary sciences · 2024Article
- Comprehensive transcriptomic analysis revealing the regulatory dynamics and networks of the pituitary-testis axis in sheep across developmental stages.Frontiers in veterinary science · 2024Article
- Detection of genetic variation in bovineAnimal biotechnology · 2023Article
- BovineCells · 2023Article
- Genetic Variations within the BovineAnimals : an open access journal from MDPI · 2022Article
- Two Different Copy Number Variations of the SOX5 and SOX8 Genes in Yak and Their Association with Growth Traits.Animals : an open access journal from MDPI · 2022Article
- GoatFrontiers in veterinary science · 2022Article
- Mining of chicken muscle growth genes and the function of important candidate geneFrontiers in physiology · 2022Article
- Detection of 15-bp Deletion Mutation withinAnimals : an open access journal from MDPI · 2021Article
- Transcriptome Analysis Reveals Genes Involved in Thermogenesis in Two Cold-Exposed Sheep Breeds.Genes · 2021Article
- Novel 61-bp Indel ofFrontiers in genetics · 2021Article
- A 17-bp InDel (rs668420586) within goat3 Biotech · 2020Article
- A 31-bp indel in the 5' UTR region of GNB1L is significantly associated with chicken body weight and carcass traits.BMC genetics · 2020Article
- A Deletion Downstream of theAnimals : an open access journal from MDPI · 2020Article
- Goat3 Biotech · 2020Article
- Determination of genetic variation within theArchives animal breeding · 2020Article
- Copy Number Variation of theAnimals : an open access journal from MDPI · 2019Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
10 authors at 2 institutions in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.