ArticleJournal of molecular neuroscience : MN2015
Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure.
Article in Journal of molecular neuroscience : MN, 2015. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 4 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
4 citing papers in PubMed, 17 citations in OpenAlex.
- Epileptic Encephalopathy of Unknown Cause in Turkey Indicates a New HomozygousMolecular syndromology · 2024Article
- A Tiny Viral Protein, SARS-CoV-2-ORF7b: Functional Molecular Mechanisms.Biomolecules · 2024Article
- Comparative analysis of hippocampal extracellular space uncovers widely altered peptidome upon epileptic seizure in urethane-anaesthetized rats.Fluids and barriers of the CNS · 2024Article
- Quantitative Changes in the Mitochondrial Proteome of Cerebellar Synaptosomes From Preclinical Cystatin B-Deficient Mice.Frontiers in molecular neuroscience · 2020Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
10 authors at 3 institutions in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.