ArticleApplied and environmental microbiology2015
A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus.
Article in Applied and environmental microbiology, 2015. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 27 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
27 citing papers in PubMed, 49 citations in OpenAlex.
- Impact of the Transcriptional Regulator SCO7424 Overexpression on Antibiotic Production inAntibiotics (Basel, Switzerland) · 2026Article
- Redox control of antibiotic biosynthesis.mBio · 2025Article
- The Transcriptional Regulator DhyR Positively Modulates Daptomycin Biosynthesis in Streptomyces roseosporus.Microbial biotechnology · 2025Article
- A rational multi-target combination strategy for synergistic improvement of non-ribosomal peptide production.Nature communications · 2025Article
- A previously unidentified sugar transporter for engineering of high-yield Streptomyces.Applied microbiology and biotechnology · 2024Article
- Metabolic engineering of Streptomyces roseosporus for increased production of clinically important antibiotic daptomycin.Microbial biotechnology · 2024Article
- Development of a group II intron-based genetic manipulation tool for Streptomyces.Microbial biotechnology · 2024Article
- Interactions between plant-beneficial microorganisms in a consortium: Streptomyces microflavus and Trichoderma harzianum.Microbial biotechnology · 2023Article
- LcbR1, a newly identified GntR family regulator, represses lincomycin biosynthesis in Streptomyces lincolnensis.Applied microbiology and biotechnology · 2023Article
- m4C DNA methylation regulates biosynthesis of daptomycin inSynthetic and systems biotechnology · 2022Article
- Transcriptional Regulator DasR Represses Daptomycin Production through Both Direct and Cascade Mechanisms inAntibiotics (Basel, Switzerland) · 2022Article
- PicR as a MarR Family Transcriptional Repressor Multiply Controls the Transcription of Picolinic Acid Degradation Gene ClusterApplied and environmental microbiology · 2022Article
- Improving the Yield and Quality of Daptomycin inFrontiers in microbiology · 2022Article
- A Major Facilitator Superfamily (MFS) Efflux Pump, SCO4121, from Streptomyces coelicolor with Roles in Multidrug Resistance and Oxidative Stress Tolerance and Its Regulation by a MarR Regulator.Applied and environmental microbiology · 2021Article
- Label-free proteomic dissection on dptP-deletion mutant uncovers dptP involvement in strain growth and daptomycin tolerance of Streptomyces roseosporus.Microbial biotechnology · 2021Article
- Uncovering and Engineering a Mini-Regulatory Network of the TetR-Family Regulator SACE_0303 for Yield Improvement of Erythromycin inFrontiers in bioengineering and biotechnology · 2021Article
- Comparative Transcriptome Analysis Demonstrates the Positive Effect of the Cyclic AMP Receptor Protein Crp on Daptomycin Biosynthesis inFrontiers in bioengineering and biotechnology · 2021Article
- Pleiotropic regulation of daptomycin synthesis by DptR1, a LuxR family transcriptional regulator.World journal of microbiology & biotechnology · 2020Article
- Pleiotropic regulation of daptomycin synthesis by DptR1, a LuxR family transcriptional regulator.World journal of microbiology & biotechnology · 2020Article
- The Application of Regulatory Cascades inFrontiers in microbiology · 2020Review
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
6 authors at 1 institution in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.