ArticleBrazilian journal of medical and biological research = Revista brasileira de pesquisas medicas e biologica2015
Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response.
Article in Brazilian journal of medical and biological research = Revista brasileira de pesquisas medicas e biologica, 2015. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 14 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
14 citing papers in PubMed, 22 citations in OpenAlex.
- Ameliorative effects ofMolecular medicine reports · 2026Article
- Exploring the impact of IL-2 cytokine family on skin barrier function: pathophysiology and therapeutic strategies.Molecular biology reports · 2026Review
- Article
- Identification of potential hub genes associated with atopic dermatitis-like recombinant human epidermal model using integrated transcriptomic and proteomic analysis.Biomolecules & biomedicine · 2024Article
- Type 2 Inflammation Contributes to Skin Barrier Dysfunction in Atopic Dermatitis.JID innovations : skin science from molecules to population health · 2022Review
- Ginsenosides repair UVB-induced skin barrier damage in BALB/c hairless mice and HaCaT keratinocytes.Journal of ginseng research · 2022Article
- The Keratinocyte as a Crucial Cell in the Predisposition, Onset, Progression, Therapy and Study of the Atopic Dermatitis.International journal of molecular sciences · 2021Review
- Skin Disease Models In Vitro and Inflammatory Mechanisms: Predictability for Drug Development.Handbook of experimental pharmacology · 2021Article
- Massively Parallel Sequencingof the Filaggrin Gene Reveals an Association Between FLG Loss-of-function Mutations and Leprosy.Acta dermato-venereologica · 2020Article
- The Delivery of α1-Antitrypsin Therapy Through Transepidermal Route: Worthwhile to Explore.Frontiers in pharmacology · 2020Article
- Photoaging Protective Effects ofEvidence-based complementary and alternative medicine : eCAM · 2020Article
- Atopic Dermatitis Studies throughFrontiers in medicine · 2017Review
- Dysregulated function of normal human epidermal keratinocytes in the absence of filaggrin.Molecular medicine reports · 2016Article
- Inactivation of mitogen-activated protein kinase signaling pathway reduces caspase-14 expression in impaired keratinocytes.Iranian journal of basic medical sciences · 2016Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
5 authors at 2 institutions in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.