ArticleJournal of bacteriology2014
Hypoxia-activated cytochrome bd expression in Mycobacterium smegmatis is cyclic AMP receptor protein dependent.
Article in Journal of bacteriology, 2014. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 21 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
21 citing papers in PubMed, 36 citations in OpenAlex.
- Inactivation of cAMP receptor protein (MSMEG_6189) increases isoniazid susceptibility inJournal of bacteriology · 2025Article
- A global deep terrestrial biosphere core microbiome.ISME communications · 2025Article
- Identification of genes associated with persistence inFrontiers in microbiology · 2024Article
- Mycobacterial Regulatory Systems Involved in the Regulation of Gene Expression Under Respiration-Inhibitory Conditions.Journal of microbiology (Seoul, Korea) · 2023Review
- Respiratory Quinone Switches from Menaquinone to Polyketide Quinone during the Development Cycle inMicrobiology spectrum · 2023Article
- Negative regulation of the acsA1 gene encoding the major acetyl-CoA synthetase by cAMP receptor protein in Mycobacterium smegmatis.Journal of microbiology (Seoul, Korea) · 2022Article
- Deciphering functional redundancy and energetics of malate oxidation in mycobacteria.The Journal of biological chemistry · 2022Article
- Uncovering interactions between mycobacterial respiratory complexes to target drug-resistantFrontiers in cellular and infection microbiology · 2022Review
- Deletion of rifampicin-inactivating mono-ADP-ribosyl transferase gene ofCurrent research in microbial sciences · 2022Article
- Syntheses and Structure-Activity Relationships ofApplied sciences (Basel, Switzerland) · 2021Article
- Host immunity increases Mycobacterium tuberculosis reliance on cytochrome bd oxidase.PLoS pathogens · 2021Article
- Bacterial Oxidases of the CytochromeAntioxidants & redox signaling · 2021Review
- Targeting the menaquinol binding loop of mycobacterial cytochrome bd oxidase.Molecular diversity · 2021Article
- Terminal Respiratory Oxidases: A Targetables Vulnerability of Mycobacterial Bioenergetics?Frontiers in cellular and infection microbiology · 2020Review
- Induction of theFrontiers in microbiology · 2020Article
- Elucidating the functional role of Mycobacterium smegmatis recX in stress response.Scientific reports · 2019Article
- Roles of Alanine Dehydrogenase and Induction of Its Gene in Mycobacterium smegmatis under Respiration-Inhibitory Conditions.Journal of bacteriology · 2018Article
- A fluorescence-based reporter for monitoring expression of mycobacterial cytochrome bd in response to antibacterials and during infection.Scientific reports · 2017Article
- Oxidative Phosphorylation as a Target Space for Tuberculosis: Success, Caution, and Future Directions.Microbiology spectrum · 2017Review
- Carbon Catabolite Repression Regulates the Production of the Unique Volatile Sodorifen ofFrontiers in microbiology · 2017Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
3 authors at 2 institutions in 2 countries.
Funding
No grant is acknowledged in the PubMed record.
Abstract
Mycobacteria are obligate aerobes and respire using two terminal respiratory oxidases, an aa3-type cytochrome c oxidase and a cytochrome bd-type menaquinol oxidase. Cytochrome bd is encoded by cydAB from the cydABDC gene cluster that is conserved throughout the mycobacterial genus. Here we report that cydAB and cydDC in Mycobacterium smegmatis constitute two separate operons under hypoxic growth conditions. The transcriptional start sites of both operons were mapped, and a series of cydA-lacZ and cydD-lacZ transcriptional reporter fusions were made to identify regulatory promoter elements. A 51-bp region was identified in the cydAB promoter that was required for maximal cydA-lacZ expression in response to hypoxia. A cyclic AMP receptor protein (CRP)-binding site (viz. GTGAN6CCACC) was identified in this region, and mutation of this site to CCCAN6CTTTC abolished cydA-lacZ expression in response to hypoxia. Binding of purified CRP (MSMEG_0539) to the cydAB promoter DNA was analyzed using electrophoretic mobility shift assays. CRP binding was dependent on GTGAN6CCACC and showed cyclic AMP (cAMP) dependency. No CRP site was present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for maximal cydD-lacZ expression. Taken together, the data indicate that CRP is a direct regulator of cydAB expression in response to hypoxia and that the regulation of cydDC expression is CRP independent and under the control of an unknown regulator.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.