Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences.

Gholamreza Motalleb

Open access · greenAbstract read

In one paragraph

Article in International journal of molecular and cellular medicine, 2014. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Not yet cited in PubMed.

0numbers the graph read from it

0cells of the map it votes in

0citing papers in PubMed

–field-weighted citation impact, top 89% of its field

1 · What the graph read from it

What it found

Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.

The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.

2 · The registry

The trial behind it

Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.

Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.

3 · Its place in the literature

Who cites it

0 citing papers in PubMed, 0 citations in OpenAlex.

No citing paper in PubMed yet.

4 · The record

Corrections and comments

PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.

5 · Who and what money

Authors and funding

1 author at 1 institution in 1 country.

Gholamreza MotallebDepartment of Biology, University of Zabol, Zabol, Iran.

Zabol University · IR

Funding

No grant is acknowledged in the PubMed record.

6 · The paper itself

Abstract

Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism's transcriptome is related to its cellular proteome.

Indexed as

genomicsmicrobiologyMolecular biologyShine-Dalgarno sequences

Identifiers

PMID24551820

PMCPMC3927391

OpenAlexW2101968943

What OpenQuestion holds

Textmetadata

LicenceCC BY

Read underepoch 390

Registered trials

None linked

Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.