ArticleJournal of bacteriology2013
Identification of a DNA-damage-inducible regulon in Acinetobacter baumannii.
Article in Journal of bacteriology, 2013. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 29 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
29 citing papers in PubMed, 40 citations in OpenAlex.
- A new component of the DNA damage response biofilm axis in Acinetobacter baumannii is a TetR-like DNA damage response regulator.FEMS microbiology letters · 2026Article
- An activator regulates the DNA damage response and anti-phage defense networks in Moraxellaceae.Nucleic acids research · 2025Article
- Identification of EppR, a Second Repressor of Error-Prone DNA Polymerase Genes in Acinetobacter baumannii.Molecular microbiology · 2025Article
- The fitness connection of antibiotic resistance.Frontiers in microbiology · 2025Article
- Differential effects of inosine monophosphate dehydrogenase (IMPDH/GuaB) inhibition inJournal of bacteriology · 2024Article
- The novel MFS efflux pump SxtP, regulated by the LysR-type transcriptional activator SxtR, is involved in the susceptibility to sulfamethoxazole/trimethoprim (SXT) and the pathogenesis ofAntimicrobial agents and chemotherapy · 2024Article
- Repression ofJournal of bacteriology · 2024Article
- Alterations in gene expression ofJournal of medicine and life · 2023Article
- DNA damage response coregulatorFrontiers in cellular and infection microbiology · 2023Article
- Locking down SOS Mutagenesis Repression in a Dynamic Pathogen.Journal of bacteriology · 2022Article
- The DdrR Coregulator of the Acinetobacter baumannii Mutagenic DNA Damage Response Potentiates UmuDAb Repression of Error-Prone Polymerases.Journal of bacteriology · 2022Article
- The Small DdrR Protein Directly Interacts with the UmuDAb Regulator of the Mutagenic DNA Damage Response in Acinetobacter baumannii.Journal of bacteriology · 2022Article
- Non-canonical LexA proteins regulate the SOS response in the Bacteroidetes.Nucleic acids research · 2021Article
- Genetic Factors Affect the Survival and Behaviors of Selected Bacteria during Antimicrobial Blue Light Treatment.International journal of molecular sciences · 2021Review
- Homodimerization and heterodimerization requirements ofCanadian journal of microbiology · 2021Article
- A corepressor participates in LexA-independent regulation of error-prone polymerases inMicrobiology (Reading, England) · 2020Article
- New Shuttle Vectors for Real-Time Gene Expression Analysis in Multidrug-Resistant Acinetobacter Species:Applied and environmental microbiology · 2019Article
- Characterization and Transcriptome Studies of Autoinducer Synthase Gene from Multidrug ResistantGenes · 2019Article
- Bacterial Cytological Profiling as a Tool To Study Mechanisms of Action of Antibiotics That Are Active against Acinetobacter baumannii.Antimicrobial agents and chemotherapy · 2019Article
- iTRAQ-Based Comparative Proteomic Analysis ofFrontiers in microbiology · 2019Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
8 authors at 4 institutions in 2 countries.
Funding
No grant is acknowledged in the PubMed record.
Abstract
The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.