ArticleBioMed research international2013
miR156- and miR171-binding sites in the protein-coding sequences of several plant genes.
Article in BioMed research international, 2013. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 13 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
13 citing papers in PubMed, 36 citations in OpenAlex.
- ComparativeFrontiers in plant science · 2026Article
- In Silico Analysis of miRNA-mRNA Binding Sites inPlants (Basel, Switzerland) · 2025Article
- Identification of C-T novel polymorphism in 3rd exon of OsSPL14 gene governing seed sequence in rice.PloS one · 2022Article
- Global Analysis of the Genetic Variations in miRNA-Targeted Sites and Their Correlations With Agronomic Traits in Rapeseed.Frontiers in genetics · 2021Article
- Identification of Bovine miRNAs with the Potential to Affect Human Gene Expression.Frontiers in genetics · 2021Article
- Article
- Article
- Prediction of clusters of miRNA binding sites in mRNA candidate genes of breast cancer subtypes.PeerJ · 2019Article
- FASTmiR: an RNA-based sensor for in vitro quantification and live-cell localization of small RNAs.Nucleic acids research · 2017Article
- A method for clustering of miRNA sequences using fragmented programming.Bioinformation · 2016Article
- Identification and expression profiles of sRNAs and their biogenesis and action-related genes in male and female cones of Pinus tabuliformis.BMC genomics · 2015Article
- Integrative Analysis of mRNA and miRNA Expression Profiles of the Tuberous Root Development at Seedling Stages in Turnips.PloS one · 2015Article
- The properties of binding sites of miR-619-5p, miR-5095, miR-5096, and miR-5585-3p in the mRNAs of human genes.BioMed research international · 2014Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
3 authors at 1 institution in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
We identified the interaction sites of several miRNAs with the mRNAs from paralogs and orthologs of the SPL and HAM genes in A. thaliana. miRNAs from the miR156 and miR157 families in A. thaliana are shown to have binding sites within the mRNAs of SPL genes. The ath-miR156a-j binding sites located in the mRNAs of the SPL paralogs contain the sequence GUGCUCUCUCUCUUCUGUCA. This sequence encodes the ALSLLS motif. miR157a-d bind to mRNAs of the SPL family at the same site. We suggest merging the miR156 and miR157 families into one family. Several SPL genes in eight plants contain conserved miR156 binding sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous in its binding sites. The ALSLLS hexapeptide is also conserved in the SPL proteins from these plants. Binding sites for ath-miR171a-c and ath-miR170 in HAM1, HAM2, and HAM3 paralog mRNAs are located in the CDSs. The conserved miRNA binding sequence GAUAUUGGCGCGGCUCAAUCA encodes the ILARLN hexapeptide. Nucleotides within the HAM1, HAM2, and HAM3 miRNA binding sites are conserved in the mRNAs of 37 orthologs from 13 plants. The miR171- and miR170-binding sites within the ortholog mRNAs were conserved and encode the ILARLN motif. We suggest that the ath-miR170 and ath-miR171a-c families should be in one family.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.