ArticlePloS one2013
Transcriptomic study reveals widespread spliced leader trans-splicing, short 5'-UTRs and potential complex carbon fixation mechanisms in the euglenoid Alga Eutreptiella sp.
Article in PloS one, 2013. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 7 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
7 citing papers in PubMed.
- PhycoCosm, a comparative algal genomics resource.Nucleic acids research · 2021Article
- Differential Gene Expression Supports a Resource-Intensive, Defensive Role for Colony Production in the Bloom-Forming Haptophyte, Phaeocystis globosa.The Journal of eukaryotic microbiology · 2019Article
- Landscape of the spliced leader trans-splicing mechanism in Schistosoma mansoni.Scientific reports · 2018Article
- Spliced leader RNA trans-splicing discovered in copepods.Scientific reports · 2015Article
- Light-promoted rhodopsin expression and starvation survival in the marine dinoflagellate Oxyrrhis marina.PloS one · 2014Article
- De novo transcriptomes of a mixotrophic and a heterotrophic ciliate from marine plankton.PloS one · 2014Article
- Tandem repeats, high copy number and remarkable diel expression rhythm of form II RuBisCO in Prorocentrum donghaiense (Dinophyceae).PloS one · 2013Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
5 authors.
Funding
No grant is acknowledged in the PubMed record.
Abstract
Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×10(6) original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga's transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5'- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.