ArticlePloS one2012
Silodosin inhibits noradrenaline-activated transcription factors Elk1 and SRF in human prostate smooth muscle.
Article in PloS one, 2012. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 6 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
6 citing papers in PubMed, 13 citations in OpenAlex.
- Mechanistic Insights and Clinical Implications of ELK1 in Solid Tumors: A Narrative Review.Cells · 2025Review
- Innervation of the developing kidney in vivo and in vitro.Biology open · 2023Article
- Transient Astrocytic Gq Signaling Underlies Remote Memory Enhancement.Frontiers in neural circuits · 2021Article
- ELK1 promotes urothelial tumorigenesis in the presence of an activated androgen receptor.American journal of cancer research · 2018Article
- Cellular Response to Titanium Dioxide Nanoparticles in Intestinal Epithelial Caco-2 Cells is Dependent on Endocytosis-Associated Structures and Mediated by EGFR.Nanomaterials (Basel, Switzerland) · 2017Article
- Silodosin inhibits the growth of bladder cancer cells and enhances the cytotoxic activity of cisplatin via ELK1 inactivation.American journal of cancer research · 2015Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
11 authors at 3 institutions in 3 countries.
Funding
No grant is acknowledged in the PubMed record.
Abstract
backgroundThe transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs.
objectiveTo examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation.
methodsProstate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA).
resultsImmunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues.
conclusionsSilodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.