ArticleChromosome research : an international journal on the molecular, supramolecular and evolutionary aspects of chromosome biology2010
Genome-wide search of the genes tagged with the consensus of 33.6 repeat loci in buffalo Bubalus bubalis employing minisatellite-associated sequence amplification.
Article in Chromosome research : an international journal on the molecular, supramolecular and evolutionary aspects of chromosome biology, 2010. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 4 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
4 citing papers in PubMed, 8 citations in OpenAlex.
- Transcriptional dynamics of homeobox C11 gene in water buffalo bubalus bubalis.DNA and cell biology · 2015Article
- Differential expression of Homeobox C11 protein in water buffalo Bubalus bubalis and its putative 3D structure.BMC genomics · 2014Article
- RsaI repetitive DNA in Buffalo Bubalus bubalis representing retrotransposons, conserved in bovids, are part of the functional genes.BMC genomics · 2011Article
- Molecular mining of alleles in water buffalo Bubalus bubalis and characterization of the TSPY1 and COL6A1 genes.PloS one · 2011Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
6 authors at 1 institution in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5' CCTCCAGCCCTCCTCCAGCCCT 3'), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.