ArticleJournal of fluorescence2010
The fluorescence properties and lifetime study of G-quadruplexes single- and double-labeled with pyrene.
Article in Journal of fluorescence, 2010. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 2 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
2 citing papers in PubMed, 5 citations in OpenAlex.
- A Sensitive Fluorescent Assay for Tetracycline Detection Based on Triple-helix Aptamer Probe and Cyclodextrin Supramolecular Inclusion.Journal of fluorescence · 2021Article
- Recent Advances in Nucleic Acid Targeting Probes and Supramolecular Constructs Based on Pyrene-Modified Oligonucleotides.Molecules (Basel, Switzerland) · 2017Review
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
2 authors at 1 institution in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
We report steady state fluorescence and lifetime emission studies of d(GGTTGGTGTGGTTGG) (TBA) and d(GGGTTAGGGTTAGGGTTAGGG) (Htelom) oligonucleotides labeled with pyrene through a 3-aminopropyl linker. Such G-rich sequences are able to self-assemble into G-quadruplexes, especially in the presence of specific cations like potassium. A comparative studies with single- and double-labeled G-quadruplexes were carried out. For each probe we have measured fluorescence decays for emission wavelength of 390 and 480 nm in the varying concentration of potassium ion. We have calculated average lifetimes <τ> for every system as well as the fractional distribution α(i) of emitting species.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.