ArticleJournal of bacteriology2010
PcaO positively regulates pcaHG of the beta-ketoadipate pathway in Corynebacterium glutamicum.
Article in Journal of bacteriology, 2010. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 15 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
15 citing papers in PubMed.
- Time-resolved transcriptomics reveals mechanisms of acute and sustained low-pH adaptation inSynthetic and systems biotechnology · 2026Article
- Engineering a robust and autonomous biological funneling for efficient valorization of lignin-related aromatics.Nature communications · 2026Article
- Precise Transcription Control Drives Optimized Catabolism of β-5-Type Lignin-Derived Dimers inJournal of agricultural and food chemistry · 2025Article
- Improving growth properties of Corynebacterium glutamicum by implementing an iron-responsive protocatechuate biosynthesis.Microbial biotechnology · 2023Article
- Deciphering the transcriptional regulation of the catabolism of lignin-derived aromatics in Rhodococcus opacus PD630.Communications biology · 2022Article
- Physiological Response ofMicroorganisms · 2020Article
- Isolation and characterization marine bacteria capable of degrading lignin-derived compounds.PloS one · 2020Article
- Microbial single-cell growth response at defined carbon limiting conditions.RSC advances · 2019Article
- Characterization of a Unique Pathway for 4-Cresol Catabolism Initiated by Phosphorylation in Corynebacterium glutamicum.The Journal of biological chemistry · 2016Article
- Variability in subpopulation formation propagates into biocatalytic variability of engineered Pseudomonas putida strains.Frontiers in microbiology · 2015Article
- Artificial oxidative stress-tolerant Corynebacterium glutamicum.AMB Express · 2014Article
- Comprehensive discovery and characterization of small RNAs in Corynebacterium glutamicum ATCC 13032.BMC genomics · 2013Article
- Study of PcaV from Streptomyces coelicolor yields new insights into ligand-responsive MarR family transcription factors.Nucleic acids research · 2013Article
- The TetR-type transcriptional repressor RolR from Corynebacterium glutamicum regulates resorcinol catabolism by binding to a unique operator, rolO.Applied and environmental microbiology · 2012Article
- Phenylacetic acid catabolism and its transcriptional regulation in Corynebacterium glutamicum.Applied and environmental microbiology · 2012Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
5 authors.
Funding
No grant is acknowledged in the PubMed record.
Abstract
We identified a new regulator, PcaO, which is involved in regulation of the protocatechuate (PCA) branch of the beta-ketoadipate pathway in Corynebacterium glutamicum. PcaO is an atypical large ATP-binding LuxR family (LAL)-type regulator and does not have a Walker A motif. A mutant of C. glutamicum in which pcaO was disrupted (RES167DeltapcaO) was unable to grow on PCA, and growth on PCA was restored by complementation with pcaO. Both an enzymatic assay of PCA 3,4-dioxygenase activity (encoded by pcaHG) and transcriptional analysis of pcaHG by reverse transcription-PCR revealed that PcaO positively regulated pcaHG. A promoter-LacZ transcriptional fusion assay suggested that PcaO interacted with the sequence upstream of pcaHG. Electrophoretic mobility shift assay (EMSA) analysis indicated that an imperfect palindromic sequence ((-78)AACCCCTGACCTTCGGGGTT(-59)) that was located upstream of the -35 region of the pcaHG promoter was essential for PcaO regulation. DNase I footprinting showed that this imperfect palindrome was protected from DNase I digestion. Site-directed mutation and EMSA tests revealed that this palindrome sequence was essential for PcaO binding to the DNA fragment. In vitro EMSA results showed that ATP weakened the binding between PcaO and its target sequence but ADP strengthened this binding, while the effect of protocatechuate on PcaO binding was dependent on the protocatechuate concentration.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.