ArticleNucleic acids research2007
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.
Article in Nucleic acids research, 2007. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 15 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
15 citing papers in PubMed, 29 citations in OpenAlex.
- Sulfolobales: Acidothermophilic archaea as models for biology and biotechnological applications.Engineering microbiology · 2026Review
- An Lrs14 family protein functions as a nucleoid-associated protein regulating cell cycle progression in Sulfolobales.Communications biology · 2025Article
- The Lrs14-Like AbfR1 Homolog From Metallosphaera sedula Is a Nucleoid-Organizing Protein.MicrobiologyOpen · 2025Article
- The Lrs14 family of DNA-binding proteins as nucleoid-associated proteins in the Crenarchaeal order Sulfolobales.Molecular microbiology · 2025Review
- Defining heat shock response for the thermoacidophilic model crenarchaeon Sulfolobus acidocaldarius.Extremophiles : life under extreme conditions · 2020Article
- FinR Regulates Expression ofApplied and environmental microbiology · 2018Article
- Transcriptional regulator-mediated activation of adaptation genes triggers CRISPR de novo spacer acquisition.Nucleic acids research · 2015Article
- An archaeal RadA paralog influences presynaptic filament formation.DNA repair · 2013Article
- Structure and function of AvtR, a novel transcriptional regulator from a hyperthermophilic archaeal lipothrixvirus.Journal of virology · 2013Article
- Solution structure of an archaeal DNA binding protein with an eukaryotic zinc finger fold.PloS one · 2013Article
- Repair of DNA double-strand breaks following UV damage in three Sulfolobus solfataricus strains.Journal of bacteriology · 2010Article
- Structure, function, and targets of the transcriptional regulator SvtR from the hyperthermophilic archaeal virus SIRV1.The Journal of biological chemistry · 2009Article
- Structural and functional characterisation of a conserved archaeal RadA paralog with antirecombinase activity.Journal of molecular biology · 2009Article
- Life in hot acid: pathway analyses in extremely thermoacidophilic archaea.Current opinion in biotechnology · 2008Review
- Transcriptional responses to biologically relevant doses of UV-B radiation in the model archaeon, Halobacterium sp. NRC-1.Saline systems · 2008Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
6 authors at 3 institutions in 2 countries.
Funding
Abstract
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.