ArticleJournal of the American Chemical Society2005
Putative DNA quadruplex formation within the human c-kit oncogene.
Article in Journal of the American Chemical Society, 2005. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 210 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
210 citing papers in PubMed, 548 citations in OpenAlex.
- Development and application of G4-Flame as a visual biosensor for G4-DNA.Nucleic acids research · 2026Article
- Stability of G/C DNA Tetraplexes at Physiological pH Formed at the Promoter-UTR Intersection of theACS omega · 2025Article
- DNA G-quadruplex profiling in skeletal muscle stem cells reveals functional and mechanistic insights.Genome biology · 2025Article
- Directly targeting G-quadruplexes contributes to the anti-multiple myeloma efficacy of Epimedokoreanin B.Acta biochimica et biophysica Sinica · 2025Article
- APE1 promotes lung adenocarcinoma through G4-mediated transcriptional reprogramming of urea cycle metabolism.iScience · 2025Article
- Altering translation allows E. coli to overcome G-quadruplex stabilizers.Nucleic acids research · 2025Article
- Effects of hydrazone-based G-quadruplex ligands onNAR cancer · 2025Article
- Investigation of simple BODIPY dyes as G-quadruplex recognizing ligands.RSC advances · 2025Article
- Kanamycin and G-Quadruplexes: An Exploration of Binding Interactions.Molecules (Basel, Switzerland) · 2024Article
- Insights into the Molecular Structure, Stability, and Biological Significance of Non-Canonical DNA Forms, with a Focus on G-Quadruplexes and i-Motifs.Molecules (Basel, Switzerland) · 2024Review
- The first embryonic landscape of G-quadruplexes related to myogenesis.BMC biology · 2024Article
- A Phenotypic Approach to the Discovery of Potent G-Quadruplex Targeted Drugs.Molecules (Basel, Switzerland) · 2024Review
- DNA G-Quadruplexes as Targets for Natural Product Drug Discovery.Engineering (Beijing, China) · 2024Article
- Spotlight on G-Quadruplexes: From Structure and Modulation to Physiological and Pathological Roles.International journal of molecular sciences · 2024Review
- Exploring the Dispersion and Electrostatic Components in Arene-Arene Interactions between Ligands and G4 DNA to Develop G4-Ligands.Journal of medicinal chemistry · 2024Article
- Choline Dihydrogen Phosphate Destabilizes G-Quadruplexes and Enhances Transcription EfficiencyACS omega · 2024Article
- G-quadruplexes in MTOR and induction of autophagy.Scientific reports · 2024Article
- Asymmetric triplex metallohelices stabilise DNA G-quadruplexes in promoter oncogene sequences and efficiently reduce their expression in cancer cells.Journal of enzyme inhibition and medicinal chemistry · 2023Article
- The Influence of Chirality on the β-Amino-Acid Naphthalenediimides/G-Quadruplex DNA Interaction.Molecules (Basel, Switzerland) · 2023Article
- Higher-order G-quadruplexes in promoters are untapped drug targets.Frontiers in chemistry · 2023Review
150 more citing papers are in PubMed but not listed here.
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
9 authors at 2 institutions in 1 country.
Funding
Abstract
The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.