ArticleJournal of molecular evolution1992
Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm.
Article in Journal of molecular evolution, 1992. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 4 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
4 citing papers in PubMed, 7 citations in OpenAlex.
- Four intracellular genomes direct weevil biology: nuclear, mitochondrial, principal endosymbiont, and Wolbachia.Proceedings of the National Academy of Sciences of the United States of America · 1999Article
- Strand asymmetry and codon usage bias in the chloroplast genome of Euglena gracilis.Proceedings of the National Academy of Sciences of the United States of America · 1999Article
- Chloroplast ribosomes and protein synthesis.Microbiological reviews · 1994Review
- Secondary structure and phylogeny of the chloroplast 23S rRNA gene from the brown alga Pylaiella littoralis.Plant molecular biology · 1993Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
3 authors at 2 institutions in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTTGGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.