ArticleNucleic acids research2004
Site-resolved stabilization of a DNA triple helix by magnesium ions.
Article in Nucleic acids research, 2004. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 6 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
6 citing papers in PubMed, 23 citations in OpenAlex.
- Dynamics Studies of DNA with Non-canonical Structure Using NMR Spectroscopy.International journal of molecular sciences · 2020Review
- Graph-Theoretic Analysis of Monomethyl Phosphate Clustering in Ionic Solutions.The journal of physical chemistry. B · 2018Article
- Quantitative analysis of the ion-dependent folding stability of DNA triplexes.Physical biology · 2011Article
- A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics.Journal of the American Chemical Society · 2009Article
- Structural lability in stem-loop 1 drives a 5' UTR-3' UTR interaction in coronavirus replication.Journal of molecular biology · 2008Article
- The global structures of a wild-type and poorly functional plant luteoviral mRNA pseudoknot are essentially identical.RNA (New York, N.Y.) · 2006Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
2 authors at 1 institution in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson-Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg2+ ions. The results reveal that Mg2+ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na+ counterions to the same helix containing Mg2+ counterions shows that these stabilizing effects result, in large part, from Mg2+ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C+*GC triads in determining the stability of DNA triple-helical structures.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.