ArticlePlant physiology2003
Cis-acting elements and DNA-binding proteins involved in CO2-responsive transcriptional activation of Cah1 encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii.
Article in Plant physiology, 2003. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 27 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
27 citing papers in PubMed, 59 citations in OpenAlex.
- Article
- Genome-Wide Identification and Expression Analysis of Cysteine-Rich Polycomb-like Protein (CPP) Gene Family in Tomato.International journal of molecular sciences · 2023Article
- Transcriptional regulation of photoprotection in dark-to-light transition-More than just a matter of excess light energy.Science advances · 2022Article
- Orchestral manoeuvres in the light: crosstalk needed for regulation of the Chlamydomonas carbon concentration mechanism.Journal of experimental botany · 2021Review
- Article
- An Update on the Metabolic Roles of Carbonic Anhydrases in the Model Alga Chlamydomonas reinhardtii.Metabolites · 2018Review
- Regulatory components of carbon concentrating mechanisms in aquatic unicellular photosynthetic organisms.Plant cell reports · 2017Review
- Concerted Up-regulation of Aldehyde/Alcohol Dehydrogenase (ADHE) and Starch inThe Journal of biological chemistry · 2017Article
- Photosystem II Subunit PsbS Is Involved in the Induction of LHCSR Protein-dependent Energy Dissipation in Chlamydomonas reinhardtii.The Journal of biological chemistry · 2016Article
- Light and CO2/cAMP Signal Cross Talk on the Promoter Elements of Chloroplastic β-Carbonic Anhydrase Genes in the Marine Diatom Phaeodactylum tricornutum.Plant physiology · 2016Article
- The Promoter of AtUSP Is Co-regulated by Phytohormones and Abiotic Stresses inFrontiers in plant science · 2016Article
- Isolation and functional characterization of a novel rice constitutive promoter.Plant cell reports · 2014Article
- Characterization of putative cis-regulatory elements in genes preferentially expressed in Arabidopsis male meiocytes.BioMed research international · 2014Article
- Article
- Activation of the carbon concentrating mechanism by CO2 deprivation coincides with massive transcriptional restructuring in Chlamydomonas reinhardtii.The Plant cell · 2012Article
- CO(2)-cAMP-responsive cis-elements targeted by a transcription factor with CREB/ATF-like basic zipper domain in the marine diatom Phaeodactylum tricornutum.Plant physiology · 2012Article
- Recent progresses on the genetic basis of the regulation of CO2 acquisition systems in response to CO2 concentration.Photosynthesis research · 2011Review
- Regulation of the expression of H43/Fea1 by multi-signals.Photosynthesis research · 2011Article
- The carbonic anhydrase isoforms of Chlamydomonas reinhardtii: intracellular location, expression, and physiological roles.Photosynthesis research · 2011Review
- A novel negative Fe-deficiency-responsive element and a TGGCA-type-like FeRE control the expression of FTR1 in Chlamydomonas reinhardtii.Journal of biomedicine & biotechnology · 2010Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
5 authors at 1 institution in 1 country.
Funding
No grant is acknowledged in the PubMed record.
Abstract
Expression of Cah1, encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii Dangeard, is activated when cells are exposed to low-CO2 conditions (0.04% [v/v]) in light. By using an arylsulfatase reporter gene, a regulatory region essential for the transcriptional activation of Cah1 was delimited to a 63-bp fragment between -293 and -231 relative to the transcription start site. Linker-scan analysis of the 63-bp region identified two enhancer elements, EE-1 (AGATTTTCACCGGTTGGAAGGAGGT) and EE-2 (CGACTTACGAA). Gel mobility shift assays indicated that nuclear extracts purified from cells grown under low-CO2 conditions in light contained DNA-binding proteins specifically interacting with EE-1 and EE-2. Gel mobility shift assays using mutant oligonucleotide probes revealed that the protein binding to EE-1 preferentially recognized a 9-bp sequence stretch (AGATTTTCA) of EE-1, containing a conserved sequence motif named EEC, GANTTNC, which is also present in EE-2. The EE-1- and EE-2-binding proteins interacted with the EECs contained in both of the two enhancer elements in vitro. Four EECs in the 5'-upstream region from -651 to -231 of Cah1 played a central role in the transcriptional activation of Cah1 under low-CO2 conditions. These EEC-binding proteins were present even in cells grown under high-CO2 conditions (5% [v/v]) or in the dark when Cah1 is not activated. On the basis of these results, the relationship between the transcriptional regulation of Cah1 and protein-binding to the enhancer elements in the 5'-upstream region of Cah1 is discussed.
Indexed as
Identifiers
What OpenQuestion holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the OpenQuestion graph.